Tandem Repeat Identification
UW-MadisonUW-MadisonTandem Repeat IdentificationAmy HauthDeborah JosephCopyrightsPublicationsAbout The Software
Visual Synopsis Sequence Overview Region Characterizations Tandem Repeat Table
Tandem repeats and regions of similarity identified in the sequence are summarized. A region of similarity is a pair of regions depicted as two vertical bars connected by arcs. Both the height of the vertical bar and the maximum height of the arc reflect the distance between comparable positions in the pair of regions. The tandem repeats depicted does not include SSRs.
Tandem repeats and regions of similarity identified in the sequence are summarized. A region of similarity is a pair of regions depicted as two vertical bars connected by arcs. Both the height of the vertical bar and the maximum height of the arc reflect the distance between comparable positions in the pair of regions. The tandem repeats depicted does not include SSRs.
Sequence Overview                               Legend

             10        20        30        40        50        60        70        80
              |         |         |         |         |         |         |         |
   1 ctcgagggacggtccactggacatgcgaatggatggtggccacagcggaggggttacagctgccgatgtgttggctaatg   80
  81 ttgaagagggcgaccttgtgaagattttaaggatgtatggtgaagagaaagcagccaagaagatagccagaggactggta  160
 161 gacgcgcgcaacgccctctttaaaatcgagaccaccaagcagctggcagatataattgaaaacatcatggatggcgggac  240
 241 caggaaggataagcttcgacgaccggcacactcagccaccaagaccttccaagccatccgcatatttgtgaacaacgaac  320
 321 taaacgagatcaactacggtatggttttggccaacgaaatcctccgtgtggatggacgcttggtgaccattaccttccac  400
 401 tcgctggaggacactatcgtgaagcgtcacatcaacggaaacgtcctggcaggcgccgccaatgctcttcccctcaagta  480
 481 ctccagccattatgcaatagacgagccagatatactagaatcactgaccaagaagagctggaaacaactacatcgccatg  560
 561 tcattgtgccagacgccgacgaggtggcgaggaacacacgcatcgatccgccaagctgagagcagccgtcaaaacaaact  640
 641 aaacgcatgtcaataaattccctcggtctagttcaaaattctctttctcagtctttaattctcccaaactctcgtcatgg  720
 721 tatgcatgtttggactgttttggttatctgccaaaccaattggcacctgctgataacgactggtttatctatttaccaca  800
 801 gttatttgcggttctcgtgcagagtttttgtttagttggattaggaaattgttgttaattgcccaggtagaatagtagtt  880
 881 tagtacagtggtaccgattctccttttcttttgattgaatatttttcagaacataatataaatagggatagaaaatcatt  960
 961 ggttagtgatgctttccacagtgcacgtatttgatgaactcgttgaactttcgagtacctcttcaagtggttgataacgg 1040
1041 aggcgggcgaatttgatatggaaattgcgtatgccagcaatttctcggttaaagccatcgtataagcttaccattcgcac 1120
1121 ttctgcggttgttttgctcccagagattggagcatgttgtggtacttaggtgccttggcatacgtcagccggtgttgttc 1200
1201 ccggctaccaattgcacgatgtgacccgcgagaaacccgaaaccgataatctcgaaggcgtctgataagggagcgggatt 1280
1281 acaaaaaatagagagaggcaccgggcggagcacctatgtgggctatagataggggtgtccgttgagtgctcagctcagtt 1360
1361 gcatagcgcgagccgagttggcgtggctagtgaggcggtactttcggtcatctggactaaaaaactttacgggcttgcgt 1440
1441 tttttcagcggagagtggacagcagagccggctatcaagatgagtggggccaagatcatatcgggcacggcggtggccaa 1520
1521 gtaagtgggcaaaactcttgcatcgtaggattcctatttatcatatccccgcctcccgttagatccattcgcgaagagct 1600
1601 gcgtaacgaggtgacggctatgagcaagcaattggcggattttgtgcccggcttaaggattgtccaggttggtggacgtg 1680
1681 aggactccaacgtttacatccgcatgaagatcaaggcggctacggagatcggtatcgatgccgcccacgtccagctgccc 1760
1761 cgatccatcaccgaggtggaactgctcgataaggtgagtttgcgacggaagcggattatgcaatatgggcaatacaatgt 1840
1841 tatatcaactgaaaaacgaaatattctctacttgaataaagttataaataataactaatcgactttaccatttcagataa 1920
1921 acgatctgaacgaggacccccgggtgcacggcatcatagtgcaaatgcccctggattgtgacacacccatcgattcgcac 2000
2001 cgaattacggacgccgtttccccggagaaggatgttgacggcttgcacacggttaacgaaggtcgcctggccatcggtga 2080
2081 ccttggtggtttcctgccctgcactccttggggttgcctggagttaattcgccgttctggagtagagatcgccggagcca 2160
2161 gggctgtggttctgggacgcagcaagatcgtgggcactcccgcctctctctcttctctcttctctcttctctcttctctc 2240
2241 ttctctcttctctcttctctcttctctcttctctcttctctcttctctcttctctcttctctcttctctcttctctcttc 2320
2321 tctcttctctcttctctcttctctcttctctcttctctcttctctcttctctcttctctctnctctcttctctcttctct 2400
2401 cttctctcttctcccttctcctctctntctccnctctgctntgttctcnggttctctctcctcccttc             2468
              |         |         |         |         |         |         |         |
Region Characterizations
Region 1 Sequence
             10        20        30        40        50        60        70        80
              |         |         |         |         |         |         |         |
2047 acacggttaacgaaggtcgcctggccatcggtgaccttggtggtttcctgccctgcactccttggggttgcctggagtta 2126
2127 attcgccgttctggagtagagatcgccggagccagggctgtggttctgggacgcagcaagatcgtgggcactcccgcctc 2206
              |         |         |         |         |         |         |         |
             10
              |
    {cttctcy}*     
2207   tctct   2211
2212 cttctct   2218
2219 cttctct   2225
2226 cttctct   2232
2233 cttctct   2239
2240 cttctct   2246
2247 cttctct   2253
2254 cttctct   2260
2261 cttctct   2267
2268 cttctct   2274
2275 cttctct   2281
2282 cttctct   2288
2289 cttctct   2295
2296 cttctct   2302
2303 cttctct   2309
2310 cttctct   2316
2317 cttctct   2323
2324 cttctct   2330
2331 cttctct   2337
2338 cttctct   2344
2345 cttctct   2351
2352 cttctct   2358
2359 cttctct   2365
2366 cttctct   2372
2373 cttctct   2379
2380 ctnctct   2386
2387 cttctct   2393
2394 cttctct   2400
2401 cttctct   2407
2408 cttctcc   2414
2415 cttctcc   2421
              |
             10        20        30        40        50
              |         |         |         |         |
2422 tctctntctccnctctgctntgttctcnggttctctctcctcccttc 2468
              |         |         |         |         |
Tandem Repeat Table
Sequence Location Region Class and Pattern Information
1290 .. 1297   SSR ag
1348 .. 1360   SSR agctc
  1348 .. 1358 SSR agctc
2204 .. 2213   SSR ct
2207 .. 2421   TR 7
2403 .. 2460   SSR ct
  2453 .. 2460 SSR ct
Copyright © 1999-2002. All rights reserved.