Tandem Repeat Identification
UW-MadisonUW-MadisonTandem Repeat IdentificationAmy HauthDeborah JosephCopyrightsPublicationsAbout The Software
Visual Synopsis Sequence Overview Region Characterizations Tandem Repeat Table
Tandem repeats and regions of similarity identified in the sequence are summarized. A region of similarity is a pair of regions depicted as two vertical bars connected by arcs. Both the height of the vertical bar and the maximum height of the arc reflect the distance between comparable positions in the pair of regions. The tandem repeats depicted does not include SSRs.
Tandem repeats and regions of similarity identified in the sequence are summarized. A region of similarity is a pair of regions depicted as two vertical bars connected by arcs. Both the height of the vertical bar and the maximum height of the arc reflect the distance between comparable positions in the pair of regions. The tandem repeats depicted does not include SSRs.
Sequence Overview                               Legend

             10        20        30        40        50        60        70        80
              |         |         |         |         |         |         |         |
   1 gaggaggatggaacactggggggagccgatacccaggacagggcagtcctggaggcaaccgttatccacctcagggaggg   80
  81 ggtggctggggtcagccccatggaggtggctggggccagcctcatggaggtggctggggccaacctcatggaggtggctg  160
 161 gggtcagccccatggtggtggctggggacagccacatggtggtggctggggacagccacatggtggtggaggctggggtc  240
 241 aaggtgtaccc                                                                       251
              |         |         |         |         |         |         |         |
Region Characterizations
Region 1 Sequence
             10        20        30        40        50        60        70        80
              |         |         |         |         |         |         |         |
   1 gaggaggatggaacactggggggagccgatacccaggacagggcagtcctggaggcaaccgttatccacctcaggga   77
              |         |         |         |         |         |         |         |
              10        20        30
               |         |         |
    {ctgggghcarcchcatggdggtgg}*     
    {ctgggghcarcchcatggdggtgg}*     
  78                 gggggtgg     85
  86 ctggggtcagccccatggaggtgg    109
 110 ctggggccagcctcatggaggtgg    133
 134 ctggggccaacctcatggaggtgg    157
 158 ctggggtcagccccatggtggtgg    181
 182 ctggggacagccacatggtggtgg    205
 206 ctggggacagccacatggtggtgg    229
               |         |         |
             10        20        30
              |         |         |
 230 aggctggggtcaaggtgtaccc  251
              |         |         |
Tandem Repeat Table
Sequence Location Region Class and Pattern Information
173 .. 181   SSR ggt
197 .. 205   SSR ggt
78 .. 229   TR 24
221 .. 232   SSR ggt
  221 .. 229 SSR ggt
  221 .. 228 SSR ggt
Copyright © 1999-2002. All rights reserved.